Metadata-Version: 2.1
Name: synbio
Version: 0.6.16
Summary: Synbio design and build library
Home-page: https://github.com/Lattice-Automation/synbio
Author: JJTimmons
Author-email: jtimmons@latticeautomation.com
License: GNU General Public License v2 (GPLv2)
Description: # synbio
        
        `synbio` is a library for designing and assembling DNA. Users can design plasmids or libraries and export multi-step build protocols. Input SeqRecords. Output assembly SeqRecords, protocols, plate maps, and robotic picklists.
        
        Documentation is available at [https://lattice-automation.github.io/synbio](https://lattice-automation.github.io/synbio)
        
        ## Installation
        
        ```bash
        pip install synbio
        ```
        
        ## Models
        
        `synbio` only expects the user to define their `Design` and `Protocol`. Several protocols are pre-defined.
        
        ### Designs
        
        All are in `synbio.designs`:
        
        - `Combinatorial` - list of SeqRecords to combinatorially anneal into all valid assemblies
        - `CombinatorialBins` - list of bins of SeqRecords for combinatorial assembly of records between bins
        - `Plasmid` - single list of SeqRecords to combine into a plasmid
        - `PlasmidLibrary` - list of list of SeqRecords to combine into plasmids
        
        ### Protocols
        
        All are in `synbio.protocols`:
        
        - `Gibson` - Gibson assembly based on [NEB's E5510](https://www.neb.com/protocols/2012/12/11/gibson-assembly-protocol-e5510)
        - `GoldenGate` - Golden Gate assembly based on [NEB's E1601](https://www.neb.com/products/e1601-neb-golden-gate-assembly-mix#Product%20Information)
        
        ## Example
        
        In the example below, the user specifies a combinatorial library design. All SeqRecords are tested for circularization with other SeqRecords. New and valid plasmids are assembled.
        
        Behind the scenes, `synbio` is filtering all combinations of SeqRecords from the design that will circularize into valid plasmids (via [circuits in a graph](https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-015-0544-x/figures/1)). After running the `protocol`, users can export plate maps (`to_csv()`), composite plasmids (`to_fasta()`, `to_genbank()`), and assembly instructions (`to_txt()`, `to_picklists()`).
        
        ```python
        """Example of a Combinatorial Golden Gate assembly with human and robot output protocols."""
        
        import os
        from Bio.SeqIO import parse
        from synbio.designs import Combinatorial
        from synbio.protocols import GoldenGate
        
        def read_all_records():
            gg_dir = os.path.join(".", "data", "goldengate")
            records = []
            for file in os.listdir(gg_dir):
                if file.endswith(".gb"):
                    records.extend(parse(os.path.join(gg_dir, file), "genbank"))
            return records
        
        # create a combinatorial library design from all valid combinations
        design = Combinatorial(read_all_records())
        
        # create a protocol using Golden Gate as the sole composite step and run
        protocol = GoldenGate(
            name="Combinatorial Golden Gate",
            design=design,
            include=["KanR"],  # only keep circularized plasmids with a KanR SeqFeature
            min_count=5,  # only keep circularized plasmids from >=5 SeqRecords
        )
        protocol.to_fasta("plasmids.fasta")  # export multi-FASTA
        protocol.to_csv("plates.csv")  # export plate layouts
        protocol.to_txt("protocol.txt")  # export human protocol
        protocol.to_picklists("picklist", platform="hamilton")  # export a hamilton picklist
        ```
        
        plasmids.fasta:
        
        ```txt
        >J23100_AB+B0032m_BC+C0012m_CD+B0015_DE+DVK_AE
        GGAGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTACTAGAGTCACACAGGAAAG
        TACTAAATGATGGTGAATGTGAAACCAGTAACGTTATACGATGTCGCAGAGTATGCCGGT
        ...
        ```
        
        plates.csv:
        
        ```csv
        Setup Wells with volumes (uL) shown:
        Plate:1,1,2,3,4,5,6,7,8,9,10,11,12
        A,B0015_DE(4),C0080_CD(18),R0010_AB(54),water(36)
        B,B0015_DE(160),DVK_AE(160),cre_CD(18),water(156)
        ...
        ```
        
        protocol.txt:
        
        ```txt
        Combinatorial GoldenGate:
        1. Setup PCR plate with (volumes) shown:
        	1.1. Dilute plasmid DNA to 75 ng/µL in 'water'
        	1.2. Create 'assembly-mix' from 1:1 T4 Ligase Buffer (10X) and NEB Golden Gate Assembly Mix
        ...
        ```
        
        picklist.gwl:
        
        ```txt
        A;Plate:2;;;15;;2.0;;;
        D;Plate:3;;;80;;2.0;;;
        W;;;;;;;;;
        ...
        ```
        
        ## Annotation
        
        In addition to DNA assembly, `synbio` exposes a plasmid annotation function in `synbio.features`. An example below shows a SeqRecord being augmented additional SeqFeatures from a curated database of common plasmid features.
        
        ```python
        from Bio.SeqIO import parse
        from synbio.features import annotate
        
        record = next(parse("plasmid.fa", "fasta"))
        record_with_features = annotate(record, identity=0.96)
        ```
        
        ## Alternatives
        
        This is a non-exhaustive list. Contact me for a comparison of these libraries/platforms and `synbio`.
        
        - [Aquarium](https://www.aquarium.bio/) is an extensive library/application for LIMS, protocol definition/execution, and workflow design. A lab operating system.
        - [Autoprotocol](https://github.com/autoprotocol/autoprotocol-python) is a specification standard for experiments in the life sciences.
        - [BioBricks](https://github.com/liaupm/BioBlocks) is a general focus, web-based editor for describing experiments in Biology.
        - [Biocoder](https://jbioleng.biomedcentral.com/articles/10.1186/1754-1611-4-13) is a C++ library with extensive protocol step definition capabilities.
        - [Plateo](https://github.com/Edinburgh-Genome-Foundry/Plateo) is a python library for planning, running and checking laboratory experiments. Great for parsing and exporting plates and picklists form multiple formats.
        - [pydna](https://github.com/BjornFJohansson/pydna) is a python DNA assembly simulation library with a human-readable description of clone and assembly strategies.
        
Keywords: synbio,lab automation,dna assembly
Platform: UNKNOWN
Classifier: Development Status :: 3 - Alpha
Classifier: License :: OSI Approved :: GNU General Public License v2 (GPLv2)
Classifier: Operating System :: OS Independent
Classifier: Programming Language :: Python :: 3
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Requires-Python: >=3
Description-Content-Type: text/markdown
