Metadata-Version: 2.0
Name: SeqFindr
Version: 0.34.0
Summary: A tool to easily create informative genomic feature plots
Home-page: http://github.com/mscook/SeqFindr
Author: Mitchell Stanton-Cook
Author-email: m.stantoncook@gmail.com
License: ECL 2.0
Platform: UNKNOWN
Classifier: Development Status :: 3 - Alpha
Classifier: Environment :: Console
Classifier: Intended Audience :: Science/Research
Classifier: License :: OSI Approved
Classifier: Natural Language :: English
Classifier: Operating System :: POSIX :: Linux
Classifier: Programming Language :: Python
Classifier: Programming Language :: Python :: 2.7
Classifier: Programming Language :: Python :: 2 :: Only
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Classifier: Topic :: Scientific/Engineering :: Visualization
Requires-Dist: numpy (==1.8.1)
Requires-Dist: scipy (==0.14.0)
Requires-Dist: matplotlib (==1.3.1)
Requires-Dist: biopython (==1.64)
Requires-Dist: ghalton (==0.6)

SeqFindr
========

SeqFindr - easily create informative genomic feature plots. It's a 
bioinfomagicians tool to detect the presence or absence of genomic features 
given a database describing these features & a set of draft and/or complete 
genomes. We work with bacterial genomes & as such SeqFindr has only been 
tested with bacterial genomes.


**I am on vacation from 08/12/14 -> 06/01/15**. User support will not happen 
in this period. **Stupidly I've done some releases the day/night before I 
leave.** 

If you have problems::

    $ # (sudo if neded)
    $ pip uninstall SeqFindr
    $ # Run the above command numerous times to ensure it's gone
    # pip install SeqFindr==0.33.1


.. image:: https://pypip.in/version/SeqFindr/badge.svg
        :target: https://pypi.python.org/pypi/SeqFindr/
        :alt: Latest Version

.. image:: https://pypip.in/download/SeqFindr/badge.svg
        :target: https://pypi.python.org/pypi/SeqFindr/
        :alt: Downloads

.. image:: https://travis-ci.org/mscook/SeqFindR.svg?branch=master
        :target: https://travis-ci.org/mscook/SeqFindR
        :alt: Build status

.. image:: https://landscape.io/github/mscook/SeqFindR/master/landscape.png
        :target: https://landscape.io/github/mscook/SeqFindR/master
        :alt: Code Health


Documentation
-------------

Please use this README.rst as the core SeqFindr user documentation. 

These are works in progress:
    * `SeqFindr documentation`_
    * `SeqFindr official site`_


News
----

**07/12/14: I am on vacation from 08/12/14 -> 06/01/15**. User support will 
not happen in this period. **Stupidly I've done some releases the day/night 
before I leave.** 

If you have problems::

    $ # (sudo if neded)
    $ pip uninstall SeqFindr
    $ # Run the above command numerous times to ensure it's gone
    # pip install SeqFindr==0.33.1


**18/11/14:** Version 0.4.0 now has new option --remove_empty_cols. It will 
strip out entire columns where no hits were detected.


**28/07/14:** Fixed a bug where axes were shifted when using newer versions 
of matplotlib. 


**Important:** Were you using a specific SeqFindr version as a dependency 
for you project and it has disappeared from PyPI? 

We recently activated a name change of SeqFind*R* to SeqFind*r*. This was to 
avoid potential users believing this was a R package. Unfortunately, PyPI 
while aware that SeqFindR and SeqFindr were different packages did not like 
the potential confusion. As a consequence the only resolution was to delete 
SeqFind*R* completely (and losing all PyPI published releases) and registering 
SeqFind*r* and starting fresh. All previous 10 releases, while not available 
on PyPi are still available on GitHub. If you require a previous release you 
can actually do something like this (SeqFindr v0.26)::

    pip install -e git://github.com/mscook/SeqFindr.git@v0.26


**Version 0.31.1 released on 10 July 2014.**

**We are now testing SeqFindr builds on both Linux & MacOSX systems.**

Best use "git log" for a changelog as the changelog_ for most recent 
changes/fixes/enhancements may not be up to date.


Citation
--------

Cite this Github repository if you use SeqFindr to generate figures 
for publications:: 

    STANTON-COOK M, NF ALIKHAN, FORDE BM, BEN ZAKOUR NL & BEATSON SA^. 
    SeqFindr - easily create informative genomic feature plots.
    https://github.com/mscook/SeqFindr.

TODO: Couple SeqFindr with ZENODO!


Installation
------------

SeqFindr is a commandline application. If you're not familiar with the 
commandline we recommend you ask local IT support to help you install it.

We now test SeqFindr builds on both Linux (Ubuntu >= 12.04) and MacOSX 
(Mavericks) systems. 

You will need to install/have installed:
    * ncbiblast >= 2.2.27
    * python >= 2.7 (**Python 3 is not supported**)

You can check these are installed by::

    $ python --version
    $ blastn -version

Installation of python or blastn (without a package manager) is beyond the 
scope of this document.

If you have both python and blastn you need to (if not already present) 
install pip_.

You can check if pip_ exists with::

    $ which pip

If you get a "not found", please read the `pip installation instructions`_. 

**If you already have pip we do suggest you upgrade it.** We are using version 
1.5.6 at the time of writing this document. 

You can upgrade pip_ like this::

    $ pip install --upgrade pip


The following python libraries_ should be installed (automatically) if you follow 
the installation instructions detailed below.

We use the following python libraries_:
    * numpy >= 1.6.1
    * scipy >= 0.10.1
    * matplotlib >= 1.1.0
    * biopython >= 1.59
    * ghalton>=0.6

These libraries will also have dependencies (i.e. atlas, lapack, fortran 
compilers, freetype and png). **These most likely won't be installed on 
your computer. Please install these before attempting the installation.**

Linux (Ubuntu)
~~~~~~~~~~~~~~

SeqFindr uses 3rd party packages that are extremely important for scientific 
computing but are notoriously difficult to install. While *pip install * 
*--user SeqFindr* may work we recommend you install these 3rd party packages 
using apt-get.

Run::

    $ sudo apt-get install python-numpy python-scipy python-matplotlib python-biopython python-dev libatlas-dev liblapack-dev gfortran libfreetype6-dev libfreetype6 libpng-dev 

Now pip_ install SeqFindr::

    $ pip install --user SeqFindr

We use the --user option of pip_ to put SeqFindr in: /home/$USER/.local/bin/
You need to add this location to you ~/.bash_profile. 

Add SeqFindr to your path::

    $ echo 'export PATH=$PATH:/home/$USER/.local/bin/' >> ~/.bash_profile

Finally install BLAST+::

    $ sudo apt-get install ncbi-blast+ 

**Test it:**

Run::

    $ SeqFindr -h 
    $ python -c 'import SeqFindr; print SeqFindr'


MacOSX (Mavericks)
~~~~~~~~~~~~~~~~~~

**You'll need to have the equivalents of python-dev libatlas-dev liblapack-dev 
gfortran libfreetype6-dev libfreetype6 & libpng-dev installed.** We had no 
problems installing SeqFindr on a recently acquired OSX Mavericks machine 
using the homebrew package manager.

The installed packages on this machine via::

    $ brew list 

Are available at this gist_.

pip install SeqFindr::

    $ pip install --user SeqFindr

We use the --user option of pip_ to put SeqFindr in: /home/$USER/.local/bin/
You need to add this location to you ~/.bash_profile. 

Add SeqFindr to your path::

    $ echo 'export PATH=$PATH:/home/$USER/.local/bin/' >> ~/.bash_profile

Finally install BLAST+::

    $ sudo brew install blast 

**Test it:**

Run::

    $ SeqFindr -h 
    $ python -c 'import SeqFindr; print SeqFindr'


Upgrading SeqFindr 
~~~~~~~~~~~~~~~~~~

You can upgrade like this::

    pip install --upgrade SeqFindr


**Please regularly check back to make sure you're running the most recent 
SeqFindr version.**



Example figure produced by SeqFindr
-----------------------------------

SeqFindr CU fimbriae genes image. 110 E. *coli* strains were investigated. 
Order is according to phylogenetic analysis. Black blocks represent gene 
presence.

.. image:: https://raw.github.com/mscook/SeqFindr/master/example/CU_fimbriae.png
    :alt: SeqFindr CU fimbriae genes image
    :align: center


SeqFindr database files
-----------------------

The SeqFindr database is in multi-fasta format. The header needs to be
formatted with *4 comma separated* elements. We concede that inventing 
another file format is annoying, but, future versions of SeqFindr will 
exploit this information.

The elements headers are:
    * identifier,
    * common name **(this is taken as the gene label in the plot)**,
    * description and 
    * species

The final element, separated by **[]** contains a classification. This
information is used by SeqFindr to draw different coloured blocks.

An example::

    >70-tem8674, bla-TEM, Beta-lactams Antibiotic resistance (ampicillin), Unknown sp. [Beta-lactams]
    AAAGTTCTGCTATGTGGCGCGGTATTATCCCGTGTTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATAC
    >70-shv86, bla-SHV, Beta-lactams Antibiotic resistance (ampicillin), Unknown sp. [Beta-lactams]
    CTCAAGCGGCTGCGGGCTGGCGTGTACCGCCAGCGGCAGGGTGGCTAACAGGGAGATAATACACAGGCGA
    >70-oxa(1)256, bla-OXA-1, Beta-lactams Antibiotic resistance (ampicillin), Unknown sp. [Beta-lactams]
    >70-tetB190, tet(B), Tetracycline Antibiotic resistance (tetracycline), Unknown sp. [Tetracycline]
    CAAAGTGGTTAGCGATATCTTCCGAAGCAATAAATTCACGTAATAACGTTGGCAAGACTGGCATGATAAG

**Note:** if you do not have all information you can simplify the expected 
database header to::

     >, bla-TEM, , [classification]


The script **vfdb_to_seqfindr** is now included in SeqFindr to convert VFDB 
formatted files (or like) to SeqFindr formatted database files.

VFDB: Virulence Factors Database (www.mgc.ac.cn/VFs/) is a reference database 
for bacterial virulence factors.

At this stage we have tested this script on limited internal datasets.
Success/mileage will depend on the consistency of the VFDB formatting.


Example usage of **vfdb_to_seqfindr**::

    # Default (will set VFDB classification identifiers as the classification)
    $ vfdb_to_seqfindr -i TOTAL_Strep_VFs.fas -o TOTAL_Strep_VFs.sqf

    # Sets any classification to blank ([ ])
    $ vfdb_to_seqfindr -i TOTAL_Strep_VFs.fas -o TOTAL_Strep_VFs.sqf -b

    # Reads a user defined classification. 1 per in same order as input 
    # sequences
    $ python convert_vfdb_to_SeqFindr.py -i TOTAL_Strep_VFs.fas -o TOTAL_Strep_VFs.sqf -c user.class


The -c (--class_file) option is very useful. Suppose you want to annotate your 
sequences of interest with user defined classification values. Simply develop a 
file containing the scheme as pass using the -c option (3rd example above). 
A sample file for the situation where you had 7 input sequences with the first 
3 Fe transporters, the next two  Toxins, the next a Misc and the final 
sequence is a Toxin would look like this::

    Fe transporter
    Fe transporter
    Fe transporter
    Toxin
    Toxin
    Misc
    Toxin


How does SeqFindr determine positive hits
-----------------------------------------

We use the following calculation::

    hsp.identities/float(record.query_length) >= tol

Where:
    * hsp.identities is number of identities in the high-scoring pairs between
      the query (database entry) and subject (contig/scaffold/mapping
      consensus),
    * record.query_length is the length of the database entry and,
    * tol is the cutoff threshold to accept a hit (0.95 default)

For a database entry of 200 bp you can have up to 10 mismatches/gaps without 
being penalised.

**Why not just use max identity?**
    * Eliminate effects of scaffolding characters/gaps,
    * Handle poor coverage etc. in mapping consensuses where N characters/gaps
      may be introduced

**What problems may this approach cause?** I'm still looking into it...


Fine grain configuration
------------------------

SeqFindr can read a configuration file. At the moment you can only redefine 
the category colors (suppose you want to use a set of fixed colors instead of 
the default randomly generated). The configuration file is expected to expand 
in the future.

To define category colors::

    touch ~/.SeqFindr.cfg
    vi ~/.SeqFindr.cfg
    # Add something like
    category_colors = [(100,60,201), (255,0,99)]

Category colors can be any RGB triplet. You could use a tool similar to this
one: http://www.colorschemer.com/online.html

For example the first row of colors in RGB is: 
(51,102,255), (102,51,255), (204,51,255), (255,51,204)


Short PCR primers
-----------------

In some cases you may want to screen using PCR primers. Please use the --short 
option. Here we adjust BLASTn parameters wordsize = 7 & Expect Value = 1000


Tutorial
--------

We provide a script_ to run all the examples. **Note:** We have changed the 
color generation code. As a consequence the background colors will be 
different when running this yourself. The results will not change.

Navigate to the SeqFindr/example directory (from git clone). The following files should be present:
    * A database file called *Antibiotic_markers.fa* 
    * An ordering file called *dummy.order* (-i option)
    * An assemblies directory containing *strain1.fa, strain2.fa and strain3.fa*
    * A consensus directory containing *strain1.fa, strain2.fa and strain3.fa*
      (-m option)

**Note:** the assembly and consensus directories contain:
    * the same number of files (3 each)
    * there is a 1-1 filename mapping (strain1.fa, strain2.fa, strain3.fa == 
      strain1.fa, strain2.fa, strain3.fa)
    * there are only fasta files. If you wish to include complete genomes 
      either download the genomes in fasta format OR convert the Genbank or 
      EMBL files to fasta format. 

The toy assemblies and consensuses were generated such that:
    * **strain1** was missing: 70-shv86, 70-ctx143 and 70-aac3(IV)380 with 
      mis-assembly of 70-aphA(1)1310 & 70-tem8674
    * **strain2** was missing: 70-oxa(7)295, 70-pse(4)348 70-ctx143, 
      70-aadA1588, 70-aadB1778 and 70-aacC(2)200
    * **strain2** was missing 70-shv86, 70-ctx143 and 70-aac3(IV)380 with 
      mis-assembly of 70-aphA(1)1310, 70-tem8674 and 70-aadA1588


Running all the examples at once
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Something like this::

    $ # Assuming you git cloned, python setup.py install
    $ cd SeqFindr/example
    $ ./run_examples.sh
    $ # See directories run1/ run2/ run3/ run4/


Run 1 - Looking at only assemblies
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Command::

    SeqFindr Antibiotic_markers.fa assemblies/ -o run1 -l 

.. image:: https://raw.github.com/mscook/SeqFindr/master/example/run1_small.png
    :alt: run1
    :align: center


Link to full size run1_.


Run 2 - Combining assembly and mapping consensus data
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Command::

    SeqFindr Antibiotic_markers.fa assemblies/ -m consensus/ -o run2 -l

.. image:: https://raw.github.com/mscook/SeqFindr/master/example/run2_small.png
    :alt: run2
    :align: center


Link to full size run2_.


Run 3 - Combining assembly and mapping consensus data with differentiation between hits
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Command::

    SeqFindr Antibiotic_markers.fa assemblies/ -m consensus/ -o run3 -l -r

.. image:: https://raw.github.com/mscook/SeqFindr/master/example/run3_small.png
    :alt: run3
    :align: center


Link to full size run3_.


The clustering dendrogram looks like this:

.. image:: https://raw.github.com/mscook/SeqFindr/master/example/dendrogram_run3_small.png
    :alt: run3 dendrogram
    :align: center


Link to full size dendrogram_.


Run 4 - Combining assembly and mapping consensus data with defined ordering
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

**Note:** the ordering file is defined using the option *--index_file*. The 
ordering file **must** contain the same number of strains as the assemblies 
directory and the strain names must agree (TODO - add a script to flag issues).

Command::

    SeqFindr Antibiotic_markers.fa assemblies/ -m consensus/ -o run4 -l -r --index_file dummy.order

.. image:: https://raw.github.com/mscook/SeqFindr/master/example/run4_small.png
    :alt: run4
    :align: center


Link to full size run4_.


How to generate mapping consensus data
--------------------------------------

**We strongly recommend that you use mapping consensus data.** It minimises 
the effects of missassembly and collapsed repeats.

We use Nesoni_. We use the database file (in multi-fasta format) as the 
reference for mapping. Nesoni_ has no issues with multifasta files as 
references (BWA will treat them as separate chromosomes). 
The workflow is something like this::

    $ nesoni make-reference myref ref-sequences.fa
    $ # for each strain
    $ #     nesoni analyse-sample: mysample myref pairs: reads1.fastq reads2.fastq
    $ #     extract the consensus.fa file


For those of you using a cluster running PBSPro see:
https://github.com/mscook/SeqFindr_nesoni
This is a script that generates a job array, submits and cleans up the
mapping results ready for input to SeqFindr.

The output from the described workflow and SeqFindr_nesoni is a consensus.fa 
file which we term the mapping consensus. This file is a multi-fasta file of 
the consensus base calls relative to the database sequences.

Caveats: 
    * you will probably want to allow multi-mapping reads (giving *--monogamous
      no --random yes* to nesoni consensus) (this is default for
      SeqFindr_nesoni), 
    * The (poor) alignment of reads at the start and the end of the database 
      genes can result in N base calls. This can result in downstream false 
      negatives.

**SeqFindr now provides a solution to minimise the effects of poor mapping at 
the start and end of the given sequences.** 

The SeqFindr option is -s or --STRIP::

    -s STRIP, --strip STRIP Strip the 1st and last N bases of mapping consensuses & database [default = 10]

By default this strips the 1st and last 10 bases from the mapping consensuses. 
We have had good results with this value. Feel free to experiment with 
different values (say, -s 0, -s 5, -s 10, -s 15). Please see image-compare_ 
a script we developed to compare the effects of different values of -s on the 
resultant figures. 


SeqFindr usage options
----------------------

See the help listing_. You can get this yourself with::

    $ SeqFindr -h


Future
------

Please see the TODO_ for future SeqFindr project directions.





.. _pip: http://www.pip-installer.org/en/latest/
.. _libraries: https://github.com/mscook/SeqFindr/blob/master/requirements.txt
.. _image-compare: https://github.com/mscook/image-compare
.. _listing: https://github.com/mscook/SeqFindr/blob/master/HELP.rst
.. _changelog: https://github.com/mscook/SeqFindr/blob/master/CHANGES.rst
.. _TODO:  https://github.com/mscook/SeqFindr/blob/master/TODO.rst
.. _script: https://raw.github.com/mscook/SeqFindr/master/example/run_examples.sh
.. _run1: https://raw.github.com/mscook/SeqFindr/master/example/run1.png
.. _run2: https://raw.github.com/mscook/SeqFindr/master/example/run2.png
.. _run3: https://raw.github.com/mscook/SeqFindr/master/example/run3.png
.. _dendrogram: https://raw.github.com/mscook/SeqFindr/master/example/dendrogram_run3.png
.. _run4: https://raw.github.com/mscook/SeqFindr/master/example/run4.png
.. _Nesoni: http://www.vicbioinformatics.com/software.nesoni.shtml
.. _SeqFindr documentation: http://seqfindr.rtfd.org
.. _SeqFindr official site: http://mscook.github.io/SeqFindR/
.. _gist: https://gist.github.com/mscook/ef7499fc9d2138f17c7f
.. _pip installation instructions: http://pip.readthedocs.org/en/latest/installing.html


