Metadata-Version: 2.0
Name: FluGibson
Version: 1.1
Summary: A Python package for designing influenza reverse genetics                  primers using the seamless cloning methods (e.g. Gibson                  assembly, CPEC assembly).
Home-page: https://github.com/ericmjl/flu-gibson
Author: Eric J. Ma
Author-email: ericmajinglong@gmail.com
License: MIT
Keywords: biology,molecular biology,cloning
Platform: UNKNOWN
Classifier: Development Status :: 3 - Alpha
Classifier: Intended Audience :: Science/Research
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Classifier: License :: OSI Approved :: MIT License
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.2
Classifier: Programming Language :: Python :: 3.3
Classifier: Programming Language :: Python :: 3.4
Requires: networkx
Requires: pandas
Requires: matplotlib
Requires: biopython

# FluGibson

![Travis Status](https://travis-ci.org/ericmjl/flu-gibson.svg)

A tool for designing primers to clone influenza polymerase segments from viral cDNA.

# Installation

The installation requires the following packages:

1. `networkx`
2. `biopython`
3. `pandas` (optional)
4. `matplotlib` (optional)

*From Github:*

1. Download this repository as a Zip file.
2. Unzip the file.
3. In your terminal, navigate to the FluGibson directory.
4. Run command: `python setup.py install`

*From PyPI: (not ready yet)*

1. (if applicable) Switch to your proper Python environment.
2. Run command: `pip install FluGibson`

*Using Conda: (not ready yet)*

1. (if applicable) Switch to your proper Python environment.
2. Run command: `conda install FluGibson`

# Usage

## Scripted

One way to use FluGibson is to use the provided script in the `/examples` directory. Copy the script to your working directory. 

Create the FASTA formatted files containing the DNA parts that you want to stitch together. For example, you would use the following FASTA definition to stitch the following 3 parts together:

    >PART_1
    >CATCTATCTCTCTACTGCGAGGCTATTCGACTGGCCGTTACTCGCCGGTACGTAGCTCGGTCTCGATCATCAGTACGTCTACGTGTCGTCGTACTTACACGGTCGCTCGGACTGACGTACGTCTACGTCGTCTGACTGA

    >PART_2
    >CTACTGTCTGCTGATGGTACGTACGTGAGTACGCGCAGCACAGACACTACTTACTCTCGCGCGAGAGCTATCTACGACTACGTACTCGTCGTACGAGCTGACTGATCGACGTAGCTTGACGTACGTATCACGTACGTATCG

    >PART_3
    >CAGCTTCGGCGCGATTACTCTACGAGCACGACGCAGCTGTCGCTGTCTGGTCTACGCTAGCGCTACGACTATCGATCAGCGTCGTACTGACGTGACGCGCATCGACGTTCGGACGTCGTCGTCGTACGACGTCTACGATGC

The parts will be joined in the order `PART_1-->PART_2-->PART_3`.

To produce the CSV file that has all of the primers listed, from the command line, run `python compute_primers.py`. You will get a CSV file, named `all_primers.csv`, that will house the primers that you will need to order.