Metadata-Version: 2.0
Name: molbery
Version: 1.0.5
Summary: A tool for Molecular biologists to design modified Molecular Beacons which works on Exonuclease III Aided Target Recycling strategy for the detection of nucleic acid signatures.
Home-page: https://github.com/bhagya-ct/molbery
Author: Manu S
Author-email: manuvaivasvata7@gmail.com
License: UNKNOWN
Keywords: molecular beacons,EATR,CEAM,EXOIII,Target recycling
Platform: UNKNOWN
Classifier: Development Status :: 5 - Production/Stable
Classifier: Intended Audience :: Science/Research
Classifier: Natural Language :: English
Classifier: Topic :: Utilities
Classifier: License :: OSI Approved :: MIT License
Classifier: Programming Language :: Python :: 2.7
Classifier: Programming Language :: Python :: 3.5
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
Classifier: Operating System :: Microsoft :: Windows
Classifier: Operating System :: POSIX :: Linux
Requires-Dist: argparse
Requires-Dist: biopython
Requires-Dist: joblib
Requires-Dist: regex
Requires-Dist: tabulate

.. image:: https://raw.githubusercontent.com/bhagya-ct/molbery/master/molbery.png

MOLecular Beacons powered by ExonucleaseIII RecYcling.
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
`Molbery`_ is a python based tool which identifies 29mer probes with 7 bases in stem, 8 in loop and 7 overhang bases from a fasta sequence. This is based on the method developed by Zuo, Xiaolei, et al. [Ref1]_ which is based on Exo III aided target recycling method for nucleic acid signature amplification. It uses the formula suggested by Howley, Peter M., et al. [Ref2]_ for calculation of melting temperature of the probes. Other than general criteria like GC content & Tm, there are special considerations in the property of the probe sequence which are reported to be optimal. More information will be available after publication of the tool in a scientific journal.

Features
--------
The latest release includes:

    supports Fasta & multi-Fasta format

    Optional GC content, Tm range & Salt Conc.

    reStructuredText Output

    BLAST connect with parallel execution 


Compatibility
-------------
 Molbery is a cross platform tool which runs on Windows, Linux and OS X with the latest major releases of python 2 & 3.

License
-------

 Molbery is an open source tool available under the OSI approved MIT license.

 Copyright (c) 2016 Bhagya C T

 Copyright (c) 2016 Manu S

 Please read the license content `here`_.

Installation
------------

 All the Python packages required for Molbery will be installed with `pip`_. 

 Run cmd with Administrator permissions in Windows.
 ::

    $ pip install molbery

 Run command with sudo permissions in Linux and OS X. 
 ::

    $ sudo pip install molbery


 You can manually download the Molbery repository or simply clone it.

 ::

    $ git clone https://github.com/bhagya-ct/molbery

Usage
-----
 After succesful installation refer command help for all available options. 
 ::

    $ molbery --help

 For a single FASTA input run
 ::

    $ molbery <path_to_fasta> --blast --out <output> -g <GC_min> -c <GC_max> -t <Tm_min> -m <Tm_max> -s <salt_conc_in_molar_units>

 For a multi-FASTA input run (Output cannot be specified for multiple seq. Default is sequence ID present in multi-FASTA)
 ::

    $ molbery <path_to_fasta> --blast --multi -g <GC_min> -c <GC_max> -t <Tm_min> -m <Tm_max> -s <salt_conc_in_molar_units>

Sample Output
-------------

 Sequence ID - <gid_of_sequence>

+---------+-------------------------------+----------+----------+---------------+---------------+
|   Probe | Molberys (29mer Probes)       |   GC (%) |   Tm (C) |   Stem Tm (C) |   Loop Tm (C) |
+=========+===============================+==========+==========+===============+===============+
|       1 | ACCGTAGAGCTACGACTACGGTACATTAC |    48.28 |     69.9 |            22 |            24 |
+---------+-------------------------------+----------+----------+---------------+---------------+
|       2 | AGTCGTATGCATACGTACGACTAAGCTAC |    44.83 |     68.9 |            20 |            24 |
+---------+-------------------------------+----------+----------+---------------+---------------+
|       3 | ACTTTTCGTGCTGAAGAAAAGTGAAAGCG |    41.38 |     66.9 |            18 |            24 |
+---------+-------------------------------+----------+----------+---------------+---------------+
|       4 | AGCTTAGACGTACGACTAAGCTACGACTA |    44.83 |     68.9 |            20 |            24 |
+---------+-------------------------------+----------+----------+---------------+---------------+
|       5 | AGATTCGAAGCGAACCGAATCTGCATACG |    48.28 |     69.9 |            20 |            24 |
+---------+-------------------------------+----------+----------+---------------+---------------+

Note: Blast Outputs are written to <Output>_blast_results/ folder with individual text file for every probe.

Authors and Contributors
------------------------

 The tool is designed and developed by Bhagya C T, Scientist-Biotechnology, Omix  Research & Diagnostics Labs and Manu S, Institute of Bioinformatics & Applied Biotechnology. The authors are grateful to Dr. Sudeshna Adak, CEO & Director, Omix Research & Diagnostics Labs for providing important technical supervision and discussions.

Source code
-----------

 The source codes of Molbery are available

 via git: https://github.com/bhagya-ct/molbery

 via Pypi: https://pypi.python.org/pypi/molbery



Credits
-------

Thanks to the Pythonistas for some wonderful plugin modules and libraries which saves a lot of Caffeine and Code!

  * `joblib`_
  * `argparse`_
  * `tabulate`_
  * `regex`_
  * `biopython`_

FAQs
----
 Q1) pip command not found?

  Ans. You probably don't have the latest release of Python. Update Python or install `pip`_.

 Q2) Installation was successful but could not find molbery command?

  Ans. You would not have given Admin or sudo permissions while installing. Run pip uninstall molbery and reinstall with Admin or sudo permissions.  

Bugs
----

If you find a bug in molbery (pypi), please try to reproduce it with latest python 2.7 and 3.5.

If the problem persists, please file a bug in the github issue tracking system in the repository `page`_. 
For questions, troubleshooting and requests, please feel free to contact us at bhagyathimmappa@gmail.com or smanu@ibab.ac.in  

References
----------
.. _Molbery: https://github.com/bhagya-ct/molbery
.. [Ref1] Zuo, X., Xia, F., Xiao, Y., & Plaxco, K. W. (2010). Sensitive and selective amplified fluorescence DNA detection based on exonuclease III-aided target recycling. Journal of the American Chemical Society, 132(6), 1816-1818.
.. [Ref2] Howley, P. M., Israel, M. A., Law, M. F., & Martin, M. A. (1979). A rapid method for detecting and mapping homology between heterologous DNAs. Evaluation of polyomavirus genomes. Journal of Biological Chemistry, 254(11), 4876-4883.
.. _here: https://github.com/bhagya-ct/molbery/blob/master/LICENSE
.. _page: https://github.com/bhagya-ct/molbery/issues
.. _pip: https://pypi.python.org/pypi/pip
.. _joblib: https://pypi.python.org/pypi/joblib
.. _argparse: https://pypi.python.org/pypi/argparse
.. _tabulate: https://pypi.python.org/pypi/tabulate
.. _regex: https://pypi.python.org/pypi/regex
.. _biopython: https://pypi.python.org/pypi/biopython


